Successfully Added to Cart
Customers also bought...
-
DNA/RNA Shield (50 ml)Cat#: R1100-50DNA/RNA Shield reagent is a DNA and RNA stabilization solution for nucleic acids in any biological sample. This DNA and RNA stabilization solution preserves the...
-
DNA/RNA Shield SafeCollect Swab Collection Kit, 1ml (CE-IVD) (1 collection kit)Cat#: R1160-EThe DNA/RNA Shield SafeCollect Swab Collection Kit is a user-friendly collection kit for stabilizing the nucleic acid content of samples collected with a swab. DNA/RNA Shield completely inactivates harmful pathogens...
Quick-ITS Plus NGS Library Prep Kit
D6424-PS1 / D6426 / D6424-PS2 / D6424-PS3 / D6424-PS4
Quick-ITS Plus NGS Library Prep Kit
Cat # | Name | Size | Price | Quantity |
---|
Documents

Highlights
- The most streamlined NGS kit with only 30 minutes of hands-on time for 96 samples.
- 100% automation ready with only a single PCR step and without the need for normalization.
- Real-time PCR enables absolute microbial copy number quantification.
Description
Amplicon Size | The final amplicon size after 1-Step PCR (targeted amplification and barcode addition) is ~480 bp. |
---|---|
Barcode Sequences | 10 bp barcodes, Available for download here (USA Only), or under the Documents section as "Barcode Sequences". |
Index Primers | Dual index (barcodes) to uniquely label samples. |
ITS Primer Sequences | (adapters not included) ITS3f (GCATCGATGAAGAACGCAGC, 20 bp), ITS4r (TCCTCCGCTTATTGATATGC, 20 bp). |
Required Equipment | Microcentrifuge, plate spinner (centrifuge), 96-well real-time quantitative PCR system (SYBR Green compatible) or standard PCR system, and 96-well real-time PCR plates. |
Sample Input | Purified microbial DNA ≤100 ng, free of PCR inhibitors. |
Sequencing Platform | Illumina MiSeq® without the need to add custom sequencing primers. Zymo Research recommends the MiSeq® Reagent Kit v3 (600-cycle). For assistance with sample sheet setup, see Appendix F. |
Q1: What samples are compatible with this kit?
Purified total DNA from any organism free from PCR inhibitors. This system has been used by Zymo Research’s Microbiomics Services team to process samples from human, water, soil, food, plants, feces, biofilms, and much more.
Q2: What is the minimum DNA input for this kit?
The system has been tested with inputs as low as 100 femtograms with no significant impact to the performance of the kit.
Q3: Why does the kit use only a single PCR amplification step?
This single PCR step combines targeted amplification of the microbial genome and the barcoding index PCR, which allows for a simple and fast workflow.
Q4: How does the kit achieve normalization?
The combination of using Equalase qPCR Premix to yield roughly equal amounts of libraries and a carefully curated barcode index list results in similar raw sequencing reads across samples.
Q5: What is the difference between the two standards included in the kit?
The ZymoBIOMICS Microbial Community DNA Standard consists of purified DNA from 8 bacteria and 2 yeasts and is useful for assessing community profile bias. The ZymoBIOMICS 16S/ITS qPCR Standard consists of a plasmid that has a single bacterial and single fungal target and is useful for quantifying copy number. Both are useful as positive controls for the library prep process.
Q6: Why is the library amplicon size not well defined in DNA fragment analysis?
Equalase amplification and the library prep design may cause some library products to not anneal well, causing a lack of a tight band. These libraries are perfectly fine because preparation for Illumina sequencing includes denaturing libraries into single strands.
Cat # | Name | Size | Price | |
---|---|---|---|---|
D4302-5-10 | ZymoBIOMICS DNase/RNase Free Water | 10 ml | $30.80 | |
D6305 | ZymoBIOMICS Microbial Community DNA Standard | 200ng | $114.40 | |
D6306 | ZymoBIOMICS Microbial Community DNA Standard | 2000ng | $228.80 | |